• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to novel hybrid interferons comprising part of an alpha -interferon and part of an omega-interferon, the N-terminal Met- or N-formyl-Met derivatives of these interferons and, if the peptide sequence of the hybrid interferon contains a glycosylation site, the N-glycosylated derivatives of these interferons, their use as medicaments and as intermediates for the immunisation of test animals and the preparation of these interferons, novel monoclonal antibodies and their use for the purification of alpha - and omega-interferons, the hybrid cell lines secreting them, and the preparation of these hybrid cell lines, a novel purification procedure for alpha - and omega-interferons with the aid of a novel antibody affinity column containing the abovementioned novel monoclonal antibodies, and the preparation of these antibodies, novel hybrid plasmids for improving the expression of the omega-interferons, and novel intermediate plasmids for preparing the novel plasmids, and their preparation.
    公开号:SU1604164A3
    申请号:SU874202086
    申请日:1987-03-09
    公开日:1990-10-30
    发明作者:Гауптманн Рудольф；Светли Петер；Мейндль Петер；Адольф Гюнтер；Фалькнер Эдгар；Бодо Герхард；Маурер-Фоги Ингрид
    申请人:Берингер Ингельгейм Интернациональ Гмбх (Фирма)；
    IPC主号:
    专利说明:

    The invention relates to genetic engineering, in particular, to a method for producing hybrid interferons of the formula
    R, -GluIlePhe - R
    CAG ATSTTS BilII
    (one)
    where Bglll means joint Bglll restriction site) -in-;
    terferon;
    R is a peptide sequence of α-interferon, encoded by the DNA sequence of this interferon before Bglll-MecTot. cut;
    R is a peptide sequence of CO-interferon, encoded by the DNA sequence of this interferon after the BgIll-cut site or
    R. is a peptide sequence of C0-interferon, encoded by the DNA sequence of this interferon in front of the BglII cut site;
    R, - peptide sequence of interferon 2, codi-. DNA sequence this interferon after the BglII site of the incision;
    or their N-terminal met- or N-formyl-met-derivatives or their N-glycosylated derivatives, as well as the replicon and control sequences of plasmid pERl03 required for ecg.
    oh
    four
    about
    four
     CM
    316041644
    5 AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3 GTGCGACTAGCGATTTTGTAAGAGGTTTTTCTCC CAAGTGAAACGGAAG
    Promoter
    GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGGGTTTAAGCT CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCGTGCAAATTCGA Promoter / Operator - - - RNA Start - Ribose, - LINTAAAGATTGA GA Promoter / Operator - - - RNA Start - Ribose, - LINTAAAGATATGA Promoter / Operator - - - RNA Start - Ribose, - LINTAAAGATTGA GA Promoter / Operator - - - RNA Start - Ribose, - LINTA AAGATTGA GA Promoter / Operator - - - RNA Start - Ribose, - LIN TAAAGATATGA
    ATTTCTACACACTAG-
    rep-gene--
    Example 1e The plasmid pAT153 is cut with BamHI and PstI restrictases. The resulting fragments are separated on a 1% agar gel and the large fragment containing the beginning of replication is ligated, ligated to a creep of the plasmid digescent digested with the same restrictase, the smaller T-DNA fragment. -ligase. In order to replicate plasmvds, the EiColi bacteria of the HB101 strain is washed with a solution of potassium chloride, the resulting co1 the competent E. co11 HB101 is mixed with the ligated DNA and incubated at 0 ° C with heating for 2 min. Then, the transformed bacteria are applied onto ampicillin-containing LB agar plates (LB-medium + + 15 g / L agar). After incubation at 37 ° C, 12 are selected from the resulting colonies and the plasmids are isolated from them. Double digestion of selected plasmids with restriction enzymes PstI-BamHI ,. Pstl-PvuII or EcoRI-BamHI and the subsequent gel electrophoresis of the obtained fragments confirm the correctness of the construction of these plasmids. The plasmid thus obtained is designated as EGPTECZZ This plasmid, transformed into E. coli HB101, exhibits the Ap (ampicillin-resistant) and Tc-resistant plasmid (Tc) (resistant to ampicillin) and Tc (resistant). tetracycline). The plasmid ragAPETZZ3 is digested with restriction enzymes Hindlll and BamHI. The fragments are separated in a 1% agar gel. The largest fragment (about 3,750 base pairs (bp)) (fragment a) containing tryptophan promoter / opera is isolated.
    five
    0
    five
    0
    five
    0
    five
    the torus, the origin of replication and the Ap gene, and are ligated with DNA encoding COj-interferon. This DNA is obtained by cutting the plasmid pRHWl1 (or pRHWl2) coding for 1-interferon with the restriction enzymes BamHI and Hindlll and subsequent separation of both fragments by gel electrophoresis, the yellow gene contained in a smaller fragment with a length of about 800 n. To carry out the replication of the resulting plasma-, MID solution of calcium chloride, they are washed with E. coliHBIOI, mixed with the reaction mixture of the ligated DNA and, after incubation at 0 ° C, the plasmid DNA is absorbed by bacteria by heating to 2 minutes. Transformed bacteria are applied to ampicillin containing LB agar plates. After incubation, 6 of the obtained colonies are selected and the plasmids are made of them, Digestion of the selected plasmids with the restriction enzymes EcoRI, Hindlll, Ncol and PstI and subsequent gel electrophoresis confirm the correctness of the design of these plasmds. The plasmid encoding COi interferon (Glu) is referred to as pRHWI4, if pRHW12 encoding O, α-interferon (GluJ, This plasmid transformed into E. coli HB101 is shown as the initial plasmid,
     using the initial plasmid pRHWl, the plasmid pRHW13, encoding (0, -interferon (Glu)) is similarly obtained. Thus obtained, the plasmid pRHW14 has in two
    times a greater degree of expression for dV -interferon (Glu) than the known plasmid pRHWlli. The plasmid ragrATEKZZ and the cR-interferon coding plasmid pRHW14 are cut by Bglll and Sphl. The resulting fragments are separated on a 1% agar gel, eluted and purified by precipitation with ethanol. After dissolution of the fragments in the TE buffer, the large fragment obtained from the plasmid is found to be ligated with the smaller fragment obtained from the plasmid pRHW14 in the presence of T-DNA ligase. To replicate the resulting plasmids with a solution of calcium chloride, the bacteria of the E. coli HB 101 strain are washed. The competent E. coli HB 101 is mixed with the ligated DNA and, after incubation with the plamid DNA, is absorbed by the bacteria by heating for 2 min. Then the transformed bacteria are applied on ampicillin-containing LB agar plates (LB-medium + 15 g / l agar). After incubation at 37 ° C, several colonies are selected and plasmids are isolated from them. Double digestion of the selected plasmid with the restriction enzymes Bglll and Sphl and gel electrophoresis of the obtained fragments confirms the correctness of the construction of these plasmids. The plasmid is designated pRH72,
    This plasmid exhibits the phenotype Ap and Tc, encodes f (l) -interferon (Glu) (Bglll).
    To obtain a hybrid interferon coding formula (I) plasmid containing a Bglll coding 6 before the joint site) (- interferon DNA sequence, two stages should be carried out if there are two Bglll cuts in the C-interferon DNA sequence as in the interferon DNA sequence (Ap) In this case, in the first stage, the pRHWlA obtained from the plasmid by cutting Bglll and Sphl into a large fragment is ligated with the ragPAEC3Z plasmid obtained by digesting with the Bglll and Sphl fragment, which encodes the C-terminus-interferon a (APO in the presence of T-DNA ligase. Dp replication of the resulting plasmids of E. coli HB101 is transformed and cultured, followed by verification of the structure of these
    five
    0
    50
    plasmids. Choose received by such. way plasmid and designate it as. pRH77. Plasmid pRH77 was cut with Bglll and the 5-terminal phosphate was removed with phosphate. Zoya tel whose intestines. Linearized plasmid pRHW77 separated in 1% agarose gel, vschel and purified by ethanol precipitation after dissolving in TE buffer was ligated with a fragment with a length of 263 noi obtained by digestion with restriction enzymes Bglll ragr ATER33 Sphl and in the presence of T-DNA ligase The E. coli HB101 bacteria are transformed and cultured, followed by checking the correctness of the plasmid construction by separating with restriction endonucleases Alul and Haelll. Here, on the basis of identical ends, the introduction of a fragment with a length of 263 p. O is carried out in two directions. The plasmid into which the Bglll fragment with a length of 263 bp is inserted in the correct expression position is designated pRH78r, and the plasmid with the wrong expression expression is designated pRH78f.
    Both transformed plasmids. in Е „coli НВ101, show the phenotype f and Tc.

    To replicate or express new plasmids, they can be introduced into a bacterial host.
    At the same time, prokaryotes are suitable, such as, for example, E. coli K12, code 294 (ATCC N 3.446), E. coli X1776 (ATCC No. 31.537), E, coli W3110 (F, h, prototroph, ATCC S 27.325), E „ coli
    HB101 ((F, hsdS20 (-, m), recA13, ara-14, proA2, lacVI, galK2, TpSL20 (smr), xyl-5, mtl-1, sup E44, J), bacilli, such as. Bacillus suhtilis and other enterobacteria
    as Salmonella typhimurium or Serratia marcenses, and various pseudomonadas To express new hybrid interferons of formula (I) in E. coli, they are transformed and cultured,
    For example, the plasmid pEB72, pRH78f and REN78GO. After the destruction of the cell walls and the removal of bacterial debris by centrifugation, the antiviral activity of the expressed polypeptides is determined in the supernatant cell fluid. Cellular supernova-. Dental fluids obtained from the E. coli strain transformed with pKH72 and from E. coli transformed with pRH78f do not have anti-viral properties. The cellular supernatant containing CO, / O-interferon (Bglll) obtained from plasmid, pRH78r, has four times more specific antiviral activity on A549 cells than interferon (Ap).
    Example2. 10 μg ragrayu in 200 μl of the reaction solution is cut 20 units BatnHI and 20 units of Pstl. Then the two fragments formed are separated in 1% agar gel (1% agar in 1xTBE buffer consisting of 10.8 g / l of tris (oxymethyl) aminomethane (hereinafter Tris), 5.5 g / l of boric acid, 0.93 g / l of disodium salt of ethylandinitrilotetraacetic acid (EDTA) and 0.5 mg / l of ethidium bromide, lifTBE is used as working buffer, electrophoresis at 5 V / cm DNA- the fragments are made visible by irradiation with UV light (254 nm) of an agar gel. The OC-containing interferon (Ap) smaller fragment is isolated by electrophoresis of DNA bands on DE-81 paper, the paper is washed with 200 mM sodium chloride; 25 mM Tris pH 7.5,
    1 mM EDTA, the DNA is eluted with 1 M sodium chloride,
    25 mM Tris pH 7.5, 1 mM EDTA and, adding 2.5 volumes of ethanol, precipitate DNA After separation by centrifugation, the DNA is dried and dissolved in a suitable volume of TE buffer consisting of 10 mM Tris pH 8.0 and 1 mM EDTUK
    10 µg of pAT153 in 200 µl of the reaction solution are also cut with 20 units of BamHI m 20 units. PstI fragments are separated. In this case, a larger fragment containing the beginning of replication will make it
    0.5 μg of purified DNA fragments in 20 μl of the reaction solution (66 W Tris pH 7.5, 100 mM sodium chloride, 10 mM magnesium chloride, 5 mM dithiotreitol, 1 mM EDTA, 1 mM adenosine trisphosphate are ligated 5 units of DNA ligase. Then, to 150 µl of the competent bacteria E. coli HB101, 1 µl of the ligation reaction product is added for 30 minutes at 0 ° C, incubated and by incubation for
    2 min at 42 ° C transform DNA (competent bacteria But coli is flooded in LB medium (10 g / l tryptone,
    5 g / l yeast extract, 5 g / l

    ABOUT
    Q
    with

    five
    sodium chloride, pH 7.5) to an optical density of 0.3 and centrifuged. Bacteria are resuspended in 0.5 volume of ice-cold solution of 50 mM calcium chloride and incubated for 30 minutes. After centrifuging again, the bacteria are suspended in 50 mM calcium chloride 1/15 of the initial volume. The suspension of bacteria is applied to LB agar plates (LB medium + 15 g / L agar) with 50 µg / ml ampicillin. After 16 hours of incubation, 12 of the formed colonies are selected, of which plasmids are isolated on a microscale. The correct design is confirmed by double digestion with restriction enzymes Pstl-BamHI, Pstl-PvuII and Ec, oRI-BamHI, followed by gel electrophoresis. Emit one plasmid, which is designated as ragRATEKZZ. E. coli transformed with parpATER33 gives the phenotype: resistance to ampicillin and tetracycline.
    10 µg of ragPATECZZ in 150 µl of the reaction solution was double digested with Hindlll, and BamHI The three DNA fragments obtained were separated on a 1% agar gel and the largest fragment, approximately 3750 bp in length, filled the fragment. This fragment has a tryptophan promoter / operator (Serratia marcescens), the start of replication and.
    10 μg of pRHW12 in 150 μl of the reaction solution was also subjected to double digestion with BamHI and Hindlll. The resulting two fragments are separated by gel electrophoresis, and a smaller fragment (fragment b), the length of which is approximately 800 bp. isolate (it contains 00-interferon (ClI) gene. .40 ng of the fragment and approximately 50 ng of fragment b in 10 μl of the reaction solution are ligated with 5 units of Td-DNA ligase. 200 μl of the suspension of competent bacteria E. coli is mixed with the solution ligation reactions, bacteria are transformed by sudden heating before and applied to LB agar plates containing 50 µl / ml ampicillin. After 16 hours of incubation at 37 C, 6 colonies are selected from which plasmid DNA is isolated on a microscale. After digestion of DNA, restricta91
    With ionic endonucleases ECoRI, indlll, Ncol or PstI and subsequent gel electrophoresis of the fragments, it was observed that one of the plasmids has the desired structure. It is designated as pRHWIA. E. coli transform pRHWU and get the phenotype Ap and Tc.
    For this, E. coli CSR 603 bacteria (F, thr-1, leuB6,., ProA2, phr-1, recAl, argE3, thi-1, uvrA6, ara-14, lacVI, galK2, xyl-5, mtl-I , gyr A98 (nalA98), rpsL31, tsx-33, A, sup E44), transformed with the plasmids pRHW12 and pRHW14, are grown in an expression medium (10 g / l ammonium phosphate, 3.5 g / l potassium hydrogenphosphate with pH 7.3, 0.5 g / l of sodium chloride, 21 g / l of casein hydrolyzate (acid-hydrolyzed, vitamin-free), tl g / l glucose, 1 mM magnesium sulfate, 0.1 mM calcium chloride, 1 mg / l thiamine hydrochloride, 20 mg / l L-cysteine, 100 mg / l ampicillin) until reaching OngQOuM O 6. 10 ml of this culture is served in an open tea Petri ku and a UV lamp (15 W) installed at a distance of 50 cm, and irradiated for 5 seconds and further for 1 hour incubated. 100 µg of D-cycloserine is added to the cultures to kill the proliferating bacteria. After 16 hours of incubation at 37 seconds, the bacteria are separated by centrifugation, washed twice with 5 ml of Gershey salt solution (5.4 g / l sodium chloride, 3.0 g / l potassium chloride, 1.1 g / l ammonium chloride, 15 mg / l of calcium chloride, 0.2 g / l of magnesium chloride as hexahydrate, 0.2 mg / l of iron trichloride, more than hexahydrate, 87 mg / l of potassium dihydrogenphosphate, 12.1 g / l of tris, pH 7 , 4) and incubated in 5 ml of Gershey medium per 100 ml of Tershey saline solution, use 2.0 ml of 20% glucose, 0.5 ml of 2% threonine, 1.0 ml of 1% leucine, 1.0 ml- 2% proline, 2% arginine , 0.1 ml of O, 1% thiamine hydrochloride,
    20 µg / ml AS-indo-acrylic acid. By adding 5 mg / ml of S-methionine and further incubating at 37 ° C for 1 h, the newly synthesized proteins are radioactively labeled. Bacteria are separated by centrifugation and in
    ten
    20
    25
    04164 0
    200 μl buffer (SDS) - dodecylsulphate, sodium phata (6.16 ml of sodium phosphate with a pH of 6.8, 2 mM EDTA, 2% SDS, 3% glycerol, 0.02% bromophenol synego, 0.66% 2 -mercaptoethanol) is ligated at 100 ° C for 5 min. The samples are then separated on a 15% polyacrylamide gel (separation gel: 15% acrylamide, 0.4% bisacrylamide, 375 mM Tris, pH 8.8, 2 mM EDTA, 0.1% SDS | collecting gel: 6% acrylamide, 0.16% bisacrylamide, 375 mM Tris, pH 6.8, 2 mM EDTA, 0.1% SDS; 55% buffer buffer: Z., 0 g / l Tris, 14.24 g / l glycerol, 0.335 g / l EDTA, 0.5 g / l, SDS; electrophoresis duration 16 hours with constant enii current 20 mA). The gel is fixed for 1 h in 20% methanol and 7.5% acetic acid, and incubated for 30 min in 5% methanol and 1% glycerol, followed by drying. Using amplifying foil gel exhibit at -80 ° C on x-ray film. Ampicillin-resistant (| -lactamase) gene product is equally labeled in both cases. G), - interferon in the case of pRHW14 is more than twice as strong as in the case of pRHW12.
    PRI me R 3. Extraction of Qj-interferon (Glu) from bacteria.
    The E. coli HB101 strain transformed with pRHW12 / pRHW14 is expressed in expression medium + 20 µg / ml IAK to OPBOOnm 20. Bacteria are destroyed by the addition of sulfuric acid to a pM value and incubation for 60 min at. Bacteria are separated by centrifugation and the biomass is frozen at the time of processing. Bacteria are resuspended in 10 volumes of 1% acetic acid. Add 2 n. The sodium hydroxide solution is adjusted to pH 10 and the suspension is stirred for 2 hours at. Then the pH value by adding 2 n. hydrochloric acid was adjusted to 7.5, and the remains of the destroyed cells were separated by centrifugation (4 ° C, 10 0000 rpm, 30 min). Interferons that the activity of the supernatant liquid (raw extract) was measured using the well-known test 55 on human A549 cells (human lung cancer cell line) infected with encephalomyocarditis virus (EGF), using in 30
    35
    40
    45
    50
    n
    the standard of the j j interferon (Ap In this case, the E. Coli biomass transformed with pRHW12 gives 100,000 units / g (average value of three independent cultures), and the clone pRHW14 gives 200,000 units / g of biomass (15 cultures).
    Example. 10 μg ragrATEKZ and pRHW14, respectively, in 130 μm of the solution is subjected to double digestion of Bgl II and Sphl. The resulting fragments are separated on a 0.8% agar gel, deoxyribonucleic acids are eluted and precipitated. Frags are dissolved in 20 µl of TE buffer. An expression plasmid for dl., - interferon (Bglll) is obtained by ligating 1 µl of a large fragment from cAMPEA with 5 µl of a small fraction of pRHW14 in 20 µl of medium in the presence of 5 units. T-DNA ligase. After transformation with E. so11 HB101 at the microscale, the plasmids of several ampicillin resistant clones obtained were isolated in the microscale and the correctness of the construction was checked by double digestion with restriction enzymes Bglll / Sphl. Choose one of the plasmids and is designated as pRH72. E. coli transformed with this plasmid has a phenotype, Tc®.
    -1 μl of a large fragment from the pRHW14 and 5 μl of the Bgl11 (2) -Sphl fragment from the parpATER33 encoding the C-terminus of the α-interferon (Ar) in 5 μl of the reaction solution are ligated 5 units. T-DNA ligase. The resulting plasmid transform E. coli HB101 and select the plasmid of the desired construct. This intermediate plasmid is referred to as pRH77C for the gene assembly kit for dl, and / o / 2 interferon (Bglll), deleted by cutting the parpATER33c Bglll fragment should be inserted into pRH77. For this, 10 µg of pRH77 is cut with Bglll in 50 µl of solution, the volume of the solution is doubled using 2v CIP buffer (- IP Phosphatase of the body intestine). 2x C1P buffer contains 100 Tris, pH 5.0, 2 mM chlorinated magnesium 0.2 mM zinc chloride. 5-terminal phosphate by adding 1 unit. CIP is removed (60 min at 37 ° C). The linearized pRH77 form is purified by agar gel electrophoresis and elution of DNA, followed by precipitation. The DNA was dissolved in 20 µl of TE buffer and 1 µl of the resulting solution together with 5 µl of a fragment with a length of 263 bp. (Bglll




    12
    0
    five
    0
    five
    0
    five
    0
    five
    0
    five
    (I) BglII (2) -fragment) obtained by digestion. Hragrotex and Bglll / Sphl in 10 μl of the reaction solution are ligated in the presence of 5 units. DNA ligase. Y. coli HB101 is transformed and the DNA of the six colonies formed is analyzed. Since the ends are identical to the introduction of a fragment with a length of 263 p. can occur in two directions; plasmids are checked for correct construction using restriction endonucleases Alul and Haelll.
    The plasmid into which the BglII fragment is inserted at the correct expression position is designated as pRHW78r, and the other with the position incorrect for expression as pRH78f. E. coli transformed with pRH78r or pRH78f, shows the phenotype of Ap, Tc. T, the E. coli strain formed by various plasmvds in 35 ml of the expression medium + 20 μg / μl of IAA at 37 ° C is grown to OD 50 cd 0.6. Bacteria are separated by centrifugation. The precipitate of bacteria is suspended in 3.5 ml of a solution of 50 mM Tris, pH 7.6, and 30 mM magnesium chloride, cooled with ice, treated with an ultrasonic disintegrator of the Sonipren-150 type at maximum power. The suspension is centrifuged for 10 min (10,000 rpm) and the supernatant is sterile: but filtered. The antiviral activity of the solution is determined using A549 cells infected with an EMC virus.
    The transformed pRH72 / COt - interferon (Bglll) bacteria E. coli do not show antiviral activity, as well as the transformed pRH78 strain E. coli, which is the first 64 amino acids of the mature COj-interferon and the subsequent serine.
    Compared to this result, CO / c r-iferferon (Bglll) shows four times more specific antiviral activity relative to A549 cells than the (He) interferor, and per 1 liter of culture with Pboron 1 kPON pRH78r produces approximately 30x10 units .. interferon.
    PRI me R 5. Purification CJj / o (terferon (Bglll).
    145 g of bacteria treated with acid and frozen at -20 ° C E. co1-316041
    li-clone HB101 / pRH78r in 1450 ml of 1% acetic acid, stirred ,. homogenized for 2 minutes at 10,000 rpm, polyamine P added to a concentration of 0.25% and addition of 5N. sodium hydroxide pH of the medium was adjusted to 10.0. Under cooling with ice, stirred for 2 h and the addition of 5 n. hydrochloric acid. "pH adjusted to 7.3. The crude product is purified by centrifugation (об000 rpm, 60 min, approximately). To the crude extract was added 430 g / l of ammonium sulfate and, until complete precipitation, was left to stand for 16 hours at. The precipitate was separated by centrifugation (10,000 rpm, 60 min, 4-8 ° C), dissolved in 145 ml of 0.01 M sodium chloride. The pH of the suspension is adjusted to 7.5 by adding 5N. sodium hydroxide. While cooling with ice, they are stirred for 3 hours and then the solution is centrifuged to transparency (10,000 rpm, 25, 60 min.). Dialized in 0.01 M sodium chloride until the interferon solution shows an osmolarity of 370 osmol / l. .
    Dual chromatography: For purification by chromatography, a DE-52 cellulose column is equilibrated with O., 025 M tris-hydrochloric acid + 0.2 M sodium chloride, pP 7.5, and connected to a 60 ml column, which contains monoclonal antibody EBI- 1 35 associated with Sepharose 4B. The column contains 480 mg of monoclonal antibody EBI-1 and is equilibrated with buffer with trisolic acid + sodium chloride, pH 7.5. Interferon solution 40 is passed through both columns, and the columns are washed with 0.025 M trissolic acid + 0.2 mol sodium chloride until the extinction of optical density at 280 nm below O, 1 is measured in zyuate only. The column containing the DE-52 cellulose is then disconnected, and the column containing the antibody is washed to OP at 280 nm in the eluate below 0.01. 50 adsorbed interferon zlyuyut 0.1 M citric acid in 25% ethylene glycol, collect the peak of the protein. The acidic eluate of the column with the antibody is adjusted to pH 4-5 by adding 2 n. ammonia and the resulting precipitate is removed by centrifugation. The final stage of purification is onon-C ion exchange chromatography. Column containing 1 ml
    thirty
    "0 5
    5 0 5
    0
    6414
    The ion exchanger is equilibrated with O, t M sodium citrate, pH 4.2, is poured into interferon and eluted with a pH gradient (buffer A: O, 1 M sodium citrate with pH value 4.2; buffer B: 0, 1 M sodium phosphate (pH 8.0). Interferon Qt exits at a pH of 7.0, the peak of interferon is collected.
    PRI me R 6. Cleaning WITH, interferon.
    a) Extraction and chromatography using glass particles having pores of 120-240 mesh. I
    794 g acid-precipitated and frozen at -20 ° C bacteria E. coli clone pRHW14 are mixed with ice cooling in 7700 ml of 1% acetic acid until complete distribution of the material (about 30 min) and using 2 n. The sodium hydroxide was adjusted to pH 10. After stirring for 2 hours while cooling with ice, the suspension was adjusted to pH 7.5 (2N hydrochloric acid and centrifuged for 1 hour at 10,000 rpm and 4 ° C. Clear transparent - 50 ml / h of sedochnik fluid is passed through a column containing 500 ml of glass particles, then the column is thoroughly washed with 0.025 M trissolic acid + 1 M sodium chloride (pH 7.5). The adsorbed interferon is eluted with 50 ml / h 0.025 M trissolic acid + O, 1 M KSCN in 50% ethylene glycol (pH 7.5). Then the interferon pool is subjected to dial From 0.025 M trisolic acid + + 0.1 M sodium chloride, and the concentration of interferon pool is achieved by adding 10% polyethylene glycol with a molecular weight of 40,000. The concentrate subjected to dialysis is clarified by centrifugation (1 h, 4 ° C, 15000 v / min)
    b) Affinity chromatography on the OMG-2 antibody on Sepharose wears.
    Purified monoclonal antibody OMG-2 is applied to sepharose 4B using cyan-activated sepharose 4B. In this case, 16 mg of monoclonal antibody per gram of activated Sepharb 4B is used. An 8 ml column is used for separation. The 4 ml / min concentrate of glass particles obtained according to Example 6a is passed through an antibody column, and then the column is washed with 0.025 M hydrochloric acid + O, 1 M sodium chloride.
    15
    pH 7.5. until the protein is no longer contained in the eluate (OD at 280 nm, the eluate is identical with the density of the wash buffer). The bound interferon is then eluted with O, 1 M citric acid in 25% ethylene glycol i (2 ml / min) and the peak of the protein is collected (OP230
    c) Chromatography on a ion exchanger mono-C; Ion exchange column is equilibrated with a solution of 0.1 M potassium phosphate
    in 25% propylene glycol, pH 6.0. The eluate containing the antibody column prepared according to Example 66 is supplied in the amount of 0.5 ml / min. Adsorbiro-. Bath interferon was eluted using as a gradient sodium chloride (buffer B 0.1 M potassium phosphate + 1 M sodium colored, pH 6.0, in 25% propylene glycol). The fractions (1 ml each) are examined for the interferon activity. The first peak () when using 46% of buffer B contains 00-interferon.
    d) Liquid chromatography under pressure using reversed phase.
    As a stationary phase,
    ten
    1604164
    This sequence confirms the amino acid sequence of the cDNA (cysteine at position 1 cannot be proven without the reduction and alkylation of the protein, and histidine at position 7 cannot be unambiguously proven.
    f) Purification of hybrid CO, / (X-interferon (Tables 1-3).
    F o rmula of the invention
    A method for producing a hybrid interferon type (consisting in that the plasmid template is digested with restriction enzymes Hindlll and feamHI, a fragment of 3750 bp is isolated, the fragment is ligated with Tij DNA ligase and BamHI-HindIII fragment of The 800 pores of the pRHW11 orpMH12 plasmid, the resulting recombinant DNA was transformed into E. coli HE 101, plasmid pRHW13 or pRHW14, ligated with the BglII-SphI fragments of the plasmid pRHW13 or pRHW14, size 3.77 kV using a 3.7 kV template, using a 3.7 kV template. 1.18 kV encoding the C-terminus of the interferon plasmid
    20
    25
    "",.about . „.-PragPTEKZZ, obtained recombinant column type VP-RP 18, 4x250 mm, -al nnv h. 30 DNA is transformed into E. col. 11 HB101, the plasmid pRH77 was isolated, the plasmid pRH77 Bglll was treated and the linearized form of plasmid pRH77 was purified and doped with
    J, T-DNA ligase with a BglII-SphI fragment of 0.26 kV plasmid parpATER 33, the resulting recombinant DNA was transformed into an E. coli 101 bacterial strain, plasmid pRHW7or was isolated
    4Q transform strain. E. coli NB101 with the pRHW78r plasmid, the transformed strain is grown, protein purification is carried out by precipitating with 10 ml of 1% acetic acid, homogeneous porous particles with a diameter of 5 µm and a pore size of 300 A, the acetonitrile gradient in the mobile phase O, 1% trifluoroacetic acid. Buffer A: O, 1% trifluoroacetic acid in water; buffer B: 0.1% trifluoroacetic acid in acetonitrile.
    Gradient 20-68% Buffer B within 28 min. Feed rate 1mp / min.
    Detection of OP2 (4 (M) 630 μg of the protein obtained according to Example 6c are passed through the column-, (interferon pool after chromatography on
    mono-c). Eluate in the area of 48-58% buffered in polyethyleneimine to a concentration of f ..: -. T.f of P-Diy 0.25%, bringing the pH to
    10 using 5 n. sodium hydroxide followed by a decrease in pH to 7.5 with 5 n. hydrochloric acid and 50% over to the resulting crude extract. 43% ammonium sulfate, centrifuged by dialysis to an osmolarity of 370 cm / l, by chromatography on DE-52 cellulose, then on Sepharose 4B monoclonal antibody EBI-1, bringing the pH of the eluate to 4.5, by centrifugation, by chromatography mono-C and elution at pH 7.
    24.5 minutes with 63% buffer. The yield is 5-10 µg, and the specific activity is 10 units / mg protein.
    d). Determination of the sequence of the N-terminal 5: amino acids.
    Obtained according to example 66 Peak O) -interferon is dried in a centrifuge with subsequent analysis. Get the following amino acid sequence:
    HKh-Asp-Leu-Pro-Glu-Asn-Xxx-Clu-Leu-. Leu-Ser1510
    55
    .17 160416418
    Table
    Extraction and chromatography using glass
    particles (CSP) with pores of 120-240 mesh size J I
    Table 2
    Affinity chromatography on OMG-2 antibody on a sepharose carrier
    权利要求:
    Claims (1)
    [1]
    Claim
    The method of obtaining a hybrid interferon type CO, / o ( g , consisting in the fact that the plasmid rarATEKZZ treated with restrictase ΗίηάΙΙΙ and Yzatn1, allocate the fragment size 3750 p. O., ligated this fragment using T 4 -DNA ligase and YourH1ΗίηάΙΙΙ-fragment size 800 bases long rMSh11 ilirVNY12 plasmid, the resulting recombinant DNA is transformed into strain Ε. so11 HB 101, or isolated plasmid rEEDLZ rKNN14 ligated V§111-BrY fragments or plasmids rKZh13 rVNI14 size of 3.77 kV with T 4 -DNA ligase and fragment of 1.18 kV encoding C ~ end of the Internet rferon plasmid ragAPTEKZZ, the resulting recombinant / nUA DNA is transformed into E. co.HB101 strain, the pKH77 plasmid is isolated, the pBH77 Ββ1 ΙΙ plasmid is purified and the linearized form of the plasmid pKH77 is digested and doped with T-DNA-lectanty; - a fragment of 0.26 kV plasmid RegPATEK 33, the obtained recombinant DNA is transformed into a strain of bacteria E. so11 101, the plasmid pKHI78g is isolated and the strain is transformed.
    10 ml of 1% acetic acid, homogenization with polyethylenimine to a concentration of 0.25%, bring the pH to 10 with 5 n. sodium hydroxide, followed by lowering the pH to 7.5 with 5 'n. hydrochloric acid and beyond. 43% ammonium sulphate is obtained with the obtained raw extract, centrifuged by dialysis to an osmolarity of 370 cmol / l, by cellulose chromatography ΏΕ-52, then bound to a monoclonal antibody ΕΒΙ-1 | sepharose 4B, adjusting the eluate pH to 4.5, centrifuging , chromatography on mono — C and elution at pH 7.
    .17. '1604164 18
    Table 1
    Extraction and chromatography using glass particles (CCS) with pores of 120-240 mesh
    ’- '. · З ι
    Product Volume,ml Interferon *ed „** Proteinmg Units Output% Raw extract 7700 190-10 619,100 9950 100 Pool afterHSC 425 53 -10 64600 11,500 28 After dialysis 410 45-10 * 1650 27300 24
    Table 2
    Affinity chromatography on the OMG-2 antibody on a sepharose carrier
    Material Volumeml Interferon *ed Protein mg Units Output,% Filed 350 40.6-10 61520 26700 100 Do not adsorb- mated 440 4.5-10 - eleven
    The eluate contained
    Craving O-Interferon 7 25.6 - U 62.84 9.0 '10 663 - but----------
    Table3
    Monon-C ionite chromatography
    Material Volume,ml Interferon *;ed **Protein,mg Units Output,%
    Filed 7 7.1440 6 2.84 2.5-10 6 100
    Pool containing α-interferon 2 3.04 4 0 6 0.72 4.2 · 10 6 43
    ------------------------__--- WITH._________________-_______
    £
    The determination of the interferon content is carried out by measuring the antiviral activity using A549 cells infected with an EHR virus, using as a standard o-interferon (Ap g ). The indicated value is the average of three independent experiments.
    ** Protein determination is carried out using serum albumin as a standard.
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1604164A3|1990-10-30|Method of producing hybride interferon
    US5359035A|1994-10-25|Bifunctional proteins including interleukin-2 | and granuloctyte macrophage colony stimulating factor |
    DK170741B1|1996-01-08|Bifunctional proteins, their preparation, a drug thereof and its use in the manufacture of a drug
    US5231176A|1993-07-27|Distinct family DNA encoding of human leukocyte interferons
    BG60443B2|1995-03-31|Improved vectors, methods for their preparation and for expressing the cloning genes
    IE881597L|1988-11-28|Expression of Human Proapolipoprotein A-I
    PL149079B1|1990-01-31|Method of obtaining polypeptides of ifn-beta type
    IE63991B1|1995-06-28|Novel fusion proteins and their purification
    US5180811A|1993-01-19|Proteins having a tnf action comprising tnf-fibromectin fusion protein
    PT96272A|1991-09-30|PROCESS FOR THE HOMOGENEOUS PRODUCTION OF NEW PLASTIC GROWTH FACTOR B-CHAIN ANALOGS
    JP2003504069A|2003-02-04|Modified human granulocyte colony stimulating factor and production method thereof
    PT89026B|1993-02-26|METHOD FOR PREPARING A NEUTROPHIL ACTIVATION FACTOR
    AU621051B2|1992-03-05|Method for purifying granulocyte-macrophage colony stimulating factor
    EP0174143A1|1986-03-12|Novel, distinct family of human leukocyte interferons, compositions containing them, methods for their production, and DNA and transfected hosts therefor
    JPH0698004B2|1994-12-07|Novel plasmid for TNF expression
    US5463029A|1995-10-31|Purification of fusion proteins comprising GM-CSF and IL-3
    EP0207165B1|1993-04-21|Polypeptide secretion-causing vector, microorganisms transformed by said vector, and process for preparing polypeptide using said microorganisms
    IL80944A|1994-10-07|Human placenta angiogenic factor capable of stimulating capillary endothelial cell protease synthesis, dna synthesis and migration
    US5306627A|1994-04-26|Process for producing a human neutrophil chemotactic factor peptide and a recombinant expression vector for the said polypeptide
    EP0672684A1|1995-09-20|Novel megakaryocyte colony stimulating factor and production thereof
    US5047504A|1991-09-10|Method for purifying granulocyte-macrophage colony stimulating factor
    AU651330B2|1994-07-21|Novel proteins with oncostatin M activity and process for their preparation
    Bollin Jr et al.1981|Partial purification and characterization of Syrian hamster interferon
    RU2708556C1|2019-12-09|RECOMBINANT PLASMID DNA p280_2GM CODING POLYPEPTIDE WITH PROPERTIES OF GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR OF HUMAN, STRAIN ESCHERICHIA COLI SG 20050/p280_2GM - PRODUCER OF POLYPEPTIDE WITH PROPERTIES OF GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR OF HUMAN AND METHOD OF OBTAINING OF SAID POLYPEPTIDE
    JP2579747B2|1997-02-12|Novel DNA encoding human interleukin 1
    同族专利:
    公开号 | 公开日
    AU600702B2|1990-08-23|
    EP0236920A2|1987-09-16|
    NO870967L|1987-09-11|
    NO870967D0|1987-03-09|
    DD266118A5|1989-03-22|
    DK120387D0|1987-03-09|
    IE940131L|1987-09-10|
    PT84427A|1987-04-01|
    GR3006844T3|1993-06-30|
    DE3782259D1|1992-11-26|
    IE60573B1|1994-07-27|
    EP0236920A3|1988-03-02|
    JPS62282595A|1987-12-08|
    DD276493A5|1990-02-28|
    EP0236920B1|1992-10-21|
    HU206896B|1993-01-28|
    PH27060A|1993-02-01|
    AT81671T|1992-11-15|
    AU6978687A|1987-09-17|
    KR870009020A|1987-10-22|
    KR950008191B1|1995-07-26|
    FI871012A0|1987-03-09|
    DE3607835A1|1987-09-24|
    IE870591L|1987-09-10|
    PT84427B|1989-10-04|
    HUT44074A|1988-01-28|
    IL81832D0|1987-10-20|
    ZA871679B|1988-11-30|
    ES2052502T3|1994-07-16|
    FI871012A|1987-09-11|
    US4917887A|1990-04-17|
    DK120387A|1987-09-11|
    FI925631A0|1992-12-11|
    FI925631A|1992-12-11|
    NZ219549A|1990-07-26|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    FI77877C|1979-04-20|1989-05-10|Technobiotic Ltd|Process for the preparation and purification of human Le-shaped interferon protein.|
    JPH064673B2|1980-11-10|1994-01-19|ゲネンテツク・インコ−ポレ−テツド|Hybrid type human leukocyte interferon|
    US4414150A|1980-11-10|1983-11-08|Genentech, Inc.|Hybrid human leukocyte interferons|
    ES506955A0|1980-11-10|1983-02-01|Genentech Inc|A PROCEDURE FOR PRODUCING AN ANTI-VIRAL POLYPEPTIDE.|
    US4456748A|1981-02-23|1984-06-26|Genentech, Inc.|Hybrid human leukocyte interferons|
    IT1167610B|1982-01-19|1987-05-13|Cetus Corp|MULTICLASS HYBRID INTERFRERON, PHARMACEUTICAL COMPOSITION CONTAINING IT AND PRODUCTION PROCESS|
    AU1155083A|1982-01-19|1983-07-28|Cetus Corporation|Multiclass hybrid interferons|
    DE3247922A1|1982-12-24|1984-06-28|Boehringer Ingelheim International GmbH, 6507 Ingelheim|DNA SEQUENCES, THEIR PRODUCTION, PLASMIDES CONTAINING THESE SEQUENCES AND THE USE THEREOF FOR THE SYNTHESIS OF EUKARYOTIC GENE PRODUCTS IN PROKARYOTS|
    DE3409966A1|1984-03-19|1985-09-26|Hoechst Ag, 6230 Frankfurt|GENE TECHNOLOGICAL PROCESS FOR PRODUCING HUMAN GAMMA INTERFERON AND MEANS FOR CARRYING OUT THIS PROCESS|
    DE3584198D1|1984-08-01|1991-10-31|Boehringer Ingelheim Int|NEW GENETIC SEQUENCES CODED BY TYPE I INTERFERON PEPTIDES AND THESE PRODUCING ORGANISMS.|
    DE3428370A1|1984-08-01|1986-02-13|Boehringer Ingelheim International GmbH, 6507 Ingelheim|Interferon, genetic sequences which code therefor, and organisms producing these|
    EP0174143B1|1984-08-27|1989-11-08|Genentech, Inc.|Novel, distinct family of human leukocyte interferons, compositions containing them, methods for their production, and dna and transfected hosts therefor|
    EP0173935A1|1984-08-31|1986-03-12|University Patents, Inc.|Hybrid lymphoblastoid-leukocyte human interferons|
    EP0205404B1|1985-06-11|1992-07-15|Ciba-Geigy Ag|Hybrid interferons|
    US4935233A|1985-12-02|1990-06-19|G. D. Searle And Company|Covalently linked polypeptide cell modulators|DE3633323A1|1986-10-01|1988-04-07|Boehringer Ingelheim Int|NEW MONOCLONAL ANTIBODIES AGAINST IFN-OMEGA, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE FOR CLEANING AND DETECTING IFN-OMEGA|
    DE3642096A1|1986-12-10|1988-06-16|Boehringer Ingelheim Int|HORSEINTERFERON|
    AT389318B|1987-10-22|1989-11-27|Boehringer Ingelheim Int|Novel hybridoma cell lines which produce novel monoclonal antibodies against IFN-omega, process for their preparation and the use of the novel monoclonal antibodies for the purification and for the detection of IFN-omega|
    US5939286A|1995-05-10|1999-08-17|University Of Florida|Hybrid interferon tau/alpha polypeptides, their recombinant production, and methods using them|
    US5015485A|1989-05-30|1991-05-14|Nabisco Brands, Inc.|Dog biscuits having a coating containing an inorganic pyrophosphate|
    US5000940A|1989-05-30|1991-03-19|Nabisco Brands, Inc.|Devices, compositions and the like having or containing an inorganic pyrophosphate|
    US5000943A|1989-05-30|1991-03-19|Nabisco Brands, Inc.|Canine biscuits containing an inorganic pyrophosphate|
    US5000973A|1989-05-30|1991-03-19|Nabisco Brands, Inc.|Nutritionally-balanced canine biscuits containing an inorganic pyrophosphate|
    US5047231A|1989-05-30|1991-09-10|Nabisco Brands, Inc.|Raw hide containing an inorganic pyrophosphate|
    EP0626448A3|1993-05-26|1998-01-14|BOEHRINGER INGELHEIM INTERNATIONAL GmbH|Process for preparing and purifying alpha-interferon|
    US6204022B1|1996-04-12|2001-03-20|Pepgen Corporation And University Of Florida|Low-toxicity human interferon-alpha analogs|
    CA2309766C|1997-11-20|2008-09-30|Vical Incorporated|Treatment of cancer using cytokine-expressing polynucleotides and compositions therefor|
    EP1062337B1|1998-03-13|2011-11-09|Brown University Research Foundation|Human n-type calcium channel isoform and uses thereof|
    US6685933B1|1998-07-28|2004-02-03|The United States Of America As Represented By The Department Of Health And Human Services|Interferon α hybrids|
    IL155730D0|2000-11-03|2003-11-23|Biomedicines Inc|Method for short-term and long-term drug dosimetry|
    FR2821625B1|2001-03-01|2003-05-16|Genodyssee|NOVEL POLYNUCLEOTIDES COMPRISING FUNCTIONAL SNP-TYPE POLYMORPHISM IN THE NUCLEOTIDE SEQUENCE OF THE IFN-ALPHA-2 GENE AS WELL AS NEW POLYPEPTIDES ENCODED BY THESE POLYNUCLEOTIDES AND THEIR THERAPEUTIC USES|
    FR2823220B1|2001-04-04|2003-12-12|Genodyssee|NOVEL ERYTHROPOIETINPOLYNUCLEOTIDES AND POLYPEPTIDES|
    KR20040022244A|2001-08-12|2004-03-11|펩젠 코포레이션|Hybrid interferon/interferon tau proteins, compositions and method of use|
    CA2522345A1|2003-04-09|2004-11-18|Neose Technologies, Inc.|Glycopegylation methods and proteins/peptides produced by the methods|
    US20030143197A1|2001-11-09|2003-07-31|Moran S. Mark|Method for treating diseases with omega interferon|
    US7731947B2|2003-11-17|2010-06-08|Intarcia Therapeutics, Inc.|Composition and dosage form comprising an interferon particle formulation and suspending vehicle|
    US11246913B2|2005-02-03|2022-02-15|Intarcia Therapeutics, Inc.|Suspension formulation comprising an insulinotropic peptide|
    WO2006083761A2|2005-02-03|2006-08-10|Alza Corporation|Solvent/polymer solutions as suspension vehicles|
    JP5143131B2|2006-05-30|2013-02-13|インターシアセラピューティクス，インコーポレイティド|Two-piece internal channel flow modulator for osmotic delivery system|
    CN102274557B|2006-08-09|2014-12-03|精达制药公司|Osmotic delivery systems and piston assemblies|
    DK2157967T3|2007-04-23|2013-04-08|Intarcia Therapeutics Inc|Suspension formulations of insulinotropic peptides and applications thereof|
    WO2009102467A2|2008-02-13|2009-08-20|Intarcia Therapeutics, Inc.|Devices, formulations, and methods for delivery of multiple beneficial agents|
    EP3323423B1|2009-09-28|2020-06-17|Intarcia Therapeutics, Inc|Rapid establishment and/or termination of substantial steady-state drug delivery|
    US20120208755A1|2011-02-16|2012-08-16|Intarcia Therapeutics, Inc.|Compositions, Devices and Methods of Use Thereof for the Treatment of Cancers|
    CA2906526A1|2013-03-15|2014-09-25|Ellen Chi|Interferon alpha and omega antibody antagonists|
    TWI713453B|2014-06-23|2020-12-21|美商健生生物科技公司|Interferon alpha and omega antibody antagonists|
    US9889085B1|2014-09-30|2018-02-13|Intarcia Therapeutics, Inc.|Therapeutic methods for the treatment of diabetes and related conditions for patients with high baseline HbA1c|
    WO2016196851A2|2015-06-03|2016-12-08|Intarcia Therapeutics, Inc.|Implant placement and removal systems|
    WO2017200943A1|2016-05-16|2017-11-23|Intarcia Therapeutics, Inc.|Glucagon-receptor selective polypeptides and methods of use thereof|
    USD860451S1|2016-06-02|2019-09-17|Intarcia Therapeutics, Inc.|Implant removal tool|
    USD840030S1|2016-06-02|2019-02-05|Intarcia Therapeutics, Inc.|Implant placement guide|
    EP3565580A1|2017-01-03|2019-11-13|Intarcia Therapeutics, Inc|Methods comprising continuous administration of a glp-1 receptor agonist and co-adminstration of a drug|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    DE19863607835|DE3607835A1|1986-03-10|1986-03-10|HYBRID INTERFERONS, THEIR USE AS MEDICINAL PRODUCTS AND AS INTERMEDIATE PRODUCTS FOR THE PRODUCTION OF ANTIBODIES AND THE USE THEREOF AND METHOD FOR THEIR PRODUCTION|
    [返回顶部]